Background: Gelatin is a hydrocolloid that is widely used in food products, especially soft candy because it contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a strong and flexible film layer, so as to produce a good product. However, as a Muslim, it must ensure that what is consumed is halal, one of which is from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real time PCR methods. Materials and Methods: The specific DNA primer design is done with PRIMERQUEST and NCBI softwares and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity performed on fresh tissue (cows, pig, dog, chickens, goats and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrom B gene was applied to analyze to candies purchased from market. Results:The method is expected to specific, sensitive and reliable for the analysis of bovine DNA in candy products. Amplification was also performed on soft candy reference from porcine-bovine mixture gelatin. Sensitivity test was perfomed by measuring  amplification at 6 dilution series (50000, 10000, 5000, 500, 50, and 10 pg) and repeatability test on porcine gelatin candies. The results show that the real time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 53,6 C. The limit of detection of porcine DNA was 10 pg. The coefficient of variation (CV) on repeatability analysis was 5.44 %. Four products from market were examined by using the primer showed three bovine DNA was detected. Conclusion: real time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can used for analysis of  Halal soft candy.